Genetics template strand of DNA

/in /by

Steps to transcribing and translating on paper:

1. Identify the template strand of DNA and start site.

2. Make mRNA copy in 5’3’ direction.

3. Copy through to the end of a given sequence. Label ends of mRNA.

4. On mRNA, identify start codon (AUG).

5. Use genetic code to translate each codon, starting with the start codon.

6. Stop translating at a stop codon. Label N and C terminus of the protein sequence.

 

The DNA below includes part of a prokaryotic promoter and gene. The transcription start site is labeled +1 with a box. This is where RNA polymerase will add the first nucleotide. Above or below the DNA, write out the sequence of the mRNA. You can continue transcribing to the end of the sequence.

 

+1

 

 

5’ATAGAACGATTTAATACCTGGAATGCCAGGAGCCTAGGGCTAC 3′

-10

 

3’TATCTTGCTAAATTATGGACCTTACGGTCCTCGGATCCCGATG 5’

 

Write out the sequence of the polypeptide/ protein that would be made from this gene.

 

If the bold A-T pair was mutated, so a C-G pair was substituted, what would the protein sequence be?

 

 

If the highlighted C-G pair was mutated, so an A-T pair was substituted, what would the protein sequence be?

 

 

If the highlighted C-G pair was deleted, what the protein sequence be?

"Is this question part of your assignment? We can help"

ORDER NOW